Functional Biology Final Exam Part 2

1.

1 point

Whether during mitosis or meiosis, sister chromatids are held together by proteins referred to as cohesins. Such molecules must ________.

persist throughout the cell cycle

be removed before meiosis can begin

be removed before sister chromatids can separate

reattach to chromosomes during G1

2.

1 point

A primary transcript in the nucleus of a eukaryotic cell is __________ the functional mRNA, whereas a primary transcript in a bacterial cell is __________ the functional mRNA.

larger than; the same size as

the same size as; smaller than

larger than; smaller than

the same size as; larger than

3.

1 point

Which of the following best describes the composition of DNA monomers?

All of the monomers contain a phosphate group and a nitrogenous base connected to a deoxyribose.

All of the monomers contain ribose connected to one of four nitrogenous bases.

All of the monomers contain a cytosine base connected to a deoxyribose

All of the monomers contain a phosphate group connected to a nitrogenous base

4.

1 point

Predict the color of a pigment that absorbs light of only green, yellow, and red wavelengths.

The pigment will appear as a mixture of green and yellow.

The pigment will appear blue.

the pigment will appear black.

the pigment will appear black

5.

1 point

FtsZ is a bacterial cytoskeletal protein that forms a contractile ring involved in bacterial cytokinesis. Its function is analogous to ________.

the cell plate of eukaryotic plant cells

the cleavage furrow of eukaryotic animal cells

the mitotic spindle of eukaryotic cells

the microtubule-organizing center of eukaryotic cells

6.

1 point

At a specific area of a chromosome, the following sequence of nucleotides is present where the chain opens to form a replication fork: 3' C C T A G G C T G C A A T C C 5' An RNA primer is formed starting at the underlined T (T) of the template. Which of the following represents the primer sequence?

5' G C C T A G G 3'

3' G C C T A G G 5'

5' A C G T T A G G 3'

5' A C G U U A G G 3'

7.

1 point

In a healthy cell, the rate of DNA repair is equal to the rate of DNA mutation. When the rate of repair lags behind the rate of mutation, what is a possible fate of the cell?

RNA may be used instead of DNA as inheritance material

The cell will become embryonic

The cell can be transformed to a cancerous cell

DNA synthesis will continue by a new mechanism

8.

1 point

What is a major difference between meiosis II and mitosis in a diploid animal?

Homologs align on the metaphase plate in meiosis II.

Sister chromatids separate in mitosis, and homologs separate in meiosis II.

Meiosis II occurs in a haploid cell, and mitosis occurs in diploid cells

Crossover takes place in meiosis II

9.

1 point

Which of the following statements best describes a phase that occurs in meiosis II?

Sister chromatids separate and begin moving to opposite sides of the cell

Crossing over of non-sister chromatids occurs.

Tetrads migrate to the metaphase plate

Homologous chromosomes separate and begin moving to opposite sides of the cell

10.

1 point

Refer to the figure above. What bases will be added to the primer as DNA replication proceeds? The bases should appear in the new strand in the order that they will be added starting at the 3' end of the primer

C, A, G, C, A, G, A

T, C, T, G, C, T, G

G, T, C, G, T, C, T

A, G, A, C, G, A, C

11.

1 point

A pair of chromosomes made of members from two parents is called

autosomes

sister chromatids

alleles

homologous chromosomes

12.

1 point

Which of the following contradicts the one-gene, one-enzyme hypothesis

A mutation in a single gene can result in a defective protein

Alkaptonuria results when individuals lack a single enzyme involved in the catalysis of homogentisic acid

Sickle cell anemia results in defective hemoglobin

A single antibody gene can code for different related proteins, depending on the splicing that takes place post-transcriptionally

13.

1 point

Measurements of the amount of DNA per nucleus were taken on a large number of cells from a growing fungus. The measured DNA levels ranged from 3 to 6 picograms per nucleus. In which stage of the cell cycle did the nucleus contain 6 picograms of DNA?

G0

G1

S

G2

14.

1 point

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

ten

nine

seven

six

15.

1 point

What are the two main products of the light-capturing reaction of photosynthesis?

Oxygen and water

ATP and NADPH

Glucose and oxygen

ATP and glucose

16.

1 point

If a cell has a diploid number of 50, how many chromosomes are present in the nucleus at the beginning of meiosis? How many chromosomes are present in each resulting nucleus at the end of meiosis 2?

Beginning: 50; End: 100

Beginning: 50; End: 50

Beginning: 50; End: 25

Beginning: 25; End: 50

17.

1 point

Which of the following is the start codon in mRNA?

AAG

AUG

UGA

GGU

18.

1 point

The sequestering of carbon in CAM plants helps them to survive by __________.

allowing the light-dependent & Calvin cycle reactions to occur at different times of the day

b. keeping carbon dioxide away from places in the leaves where it would be toxic

allowing carbon dioxide to be gathered and used at different times of the day

d. allowing plants to produce sugars in the winter when leaves are dead

19.

1 point

In what direction is RNA synthesized during transcription?

3′ to 5

5′ to 3

both 5′ to 3′ and 3′ to 5′ to form the double helix

It depends on which strand RNA polymerase uses

20.

1 point

In an analysis of the nucleotide composition of DNA, which of the following will be found?

A = C

A = G and C = T

A + C = G + T

G + C = T + A

21.

1 point

The M-phase checkpoint ensures that all chromosomes are attached to the mitotic spindle. If this does NOT happen, cells would most likely be arrested in ________.

prophase

telophase

anaphase

metaphase

22.

1 point

Given the DNA template shown in the associated figure, which of the following bases would you find in a complementary RNA strand and where would they be synthesized?

A-A-A-A-A; nucleus

U-U-U-U-U; nucleus

A-A-A-A-A; ribosome

U-U-U-U-U; ribosome

23.

1 point

Which of the following statements about transcription in bacteria and eukaryotes is true?

Transcription of DNA to mRNA occurs within the nucleus of prokaryotic cells.

Bacteria use only one RNA polymerase to transcribe RNA, whereas eukaryotes use three.

DNA is transcribed to protein within the nucleus of a eukaryotic cell

Transcription and translation occur simultaneously in both bacteria and eukaryotes

24.

1 point

What happens to introns in eukaryotic mRNA?

snRNPs bind to the primary transcript and form the spliceosome, which removes introns.

A 5′ cap is added to the primary RNA transcript, removing introns.

A poly(A) tail is added to the primary RNA transcript, removing introns

A ribosome binds to the primary transcript and modifies it, removing introns

25.

1 point

25. Electrons excited by absorption of light in photosystem II are transferred to plastoquinone via pheophytin, and, therefore, must be replaced. The replacement electrons come from __________.

water

photosystem 1

oxygen

chytochrome

26.

1 point

In green plants, the primary function of the Calvin cycle is to _________________.

split water and release oxygen

construct simple sugars from carbon dioxide

transport RuBP out of the chloroplast

convert energy stored in simple sugars to ATP

27.

1 point

24. Chlorophyll consists of a magnesium-containing head and a long, hydrophobic hydrocarbon tail. Why is the tail region important to the molecule's function?

The tail region donates electrons to an electron acceptor.

The tail region anchors chlorophyll in the thylakoid membrane

The tail region captures the energy in sunlight.

The tail attracts water molecule needed in photosynthesis.

28.

1 point

The poly(A) tail at the end of eukaryotic mRNA __________.

adds the 5′ cap to the end of mRNA

allows ribosomes to initiate translation at the 3′ end of the mRNA

codes for the hydrolysis of the RNA polymerase

helps protect the mRNA from degradation by enzymes in the cytoplasm

29.

1 point

Gametes _________________.

are the product of a zygote being fertilized

become sperm and egg cells after gametogenesis

are the direct product of a zygote

fuse to form a zygote

30.

1 point

Mitotic spindle fibers are composed of what cellular components?

Microtubules

Centrosomes

centromeres

kinectchores

31.

1 point

Some cells have several nuclei per cell. How could such multinucleated cells be explained?

The cell underwent repeated cytokinesis but no mitosis.

The cell underwent repeated mitosis with simultaneous cytokinesis.

The cell underwent repeated mitosis, but cytokinesis did not occur.

The cell had multiple S phases before it entered mitosis

32.

1 point

Which of the following are proteins that associate with promoters in bacteria during transcription

Sigma

RNA polymerase

TATA box

Basal transcription factors

33.

1 point

After telophase I of meiosis, the chromosomal makeup of each daughter cell is ________.

diploid, and the chromosomes are each composed of a single chromatid

diploid, and the chromosomes are each composed of two chromatids

c. haploid, and the chromosomes are each composed of a single chromatid

Haploid, and the chromosomes are each composed of two chromatids

34.

1 point

Which of the following conditions will most likely prevent a cell from passing the G1 checkpoint?

Chromosomes have not attached to the spindle apparatus

Chromosomes have not properly segregated

DNA is damaged

Abundance of MPF

35.

1 point

All three domains (Bacteria, Archaea, and Eukarya) follow the same genetic code. Therefore, which of the following statements would most likely be correct?

The genetic code evolved three times

The genetic code evolved before DNA replaced RNA as the unit of genetic information

There were no mutations following the evolution of the genetic code

The genetic code evolved before the different domains diverged

36.

1 point

Why is it critical for plants to maintain a high concentration of carbon dioxide in the leaves?

It is the only substrate for rubisco.

Oxygen will not be produced without it.

It is necessary for regeneration of RuBP from G3P.

It helps prevent photorespiration

37.

1 point

Which of the following best describes the processing of eukaryotic pre-mRNAs in the proper order?

The addition of a poly(A) tail; removal of introns; RNA polymerase termination

The addition of a poly(A) tail; addition of a 5′ cap; RNA polymerase termination

The addition of a 5′ cap; removal of introns; Poly (A) tail

The addition of a 5′ cap; removal of introns; RNA polymerase termination

38.

1 point

Which of the following statements about crossing over is true

Chromosomes that result from crossing over have a mixture of paternal and maternal alleles

Chiasmata form between sister chromatids

It occurs in prophase of meiosis II.

It decreases the genetic variability of gametes produced by meiosis

39.

1 point

Translation is

the coding from DNA to RNA

the coding from mRNA to proteins

the coding from RNA to DNA

the coding from DNA to DNA

40.

1 point

What is the function of mRNA

To translate RNA to DNA

To transcribe RNA to DNA

To carry information from DNA out of the nucleus to the site of protein synthesis

To move manufactured proteins out of the nucleus

41.

1 point

The Z scheme is ______________.

the characteristic path of electrons from photosystem II to photosystem I.

another name for the splitting of water.

the passing of high-energy electrons to lower-energy electron carriers.

the addition of CO2 to RuBP to form a six-carbon sugar

42.

1 point

RNA polymerase reads the template strand. The non-template strand is ________.

the non-coding strand—its sequence matches the sequence of the DNA that is transcribed from the template strand

the non-coding strand—its sequence matches the sequence of the RNA that is transcribed from the template strand

the coding strand—its sequence matches the sequence of the DNA that is transcribed from the template strand

the coding strand—its sequence matches the sequence of the RNA that is transcribed from the template strand

43.

1 point

The secondary structure of a double-stranded DNA helix molecule can best be described as a ______________.

Sugar-phosphate backbone with the bases of the complementary base pairs adenine-thymine and guanine-cytosine projecting toward the inside of the backbone

sugar-phosphate backbone with the complementary base pairs adenine-guanine and thyminecytosine joined by hydrogen bonding

sugar-phosphate backbone with adenine, thymine, guanine, or cytosine bases projecting toward the outside of the backbone

sugar-phosphate backbone that is made up of adenine, thymine, guanine, or cytosine bases hydrogen- bonded to each other through phosphodiester bonds

44.

1 point

Where in a plant cell does glycolysis take place?

cytosol

In the chloroplast

In the mitochondria

in lysosomes

45.

1 point

How does a nucleus in G2 differ from a nucleus in G1?

The G2 nucleus has double the amount of DNA as the G1 nucleus.

DNA synthesis occurs in the G1 phase.

In the G2 phase, cells are inactive.

Cyclin concentrations reach their peak during G1

46.

1 point

Which of the following is a stop codon

AAG

AUG

UGA

GGU

47.

1 point

A cell in late anaphase of mitosis will have ________.

no chromosomes in the center of the cell

chromosomes clustered at one end of the cell

individual chromatids beginning to separate from one another

chromosomes clustered tightly at the center

48.

1 point

Which of the following statements is true of DNA synthesis?

DNA polymerases catalyze the random addition of monomers to the DNA polymer chain

DNA polymerase requires a single-stranded template plus a primer to synthesize DNA.

DNA polymerases add nucleotides in the 3′ to 5′ direction to complete the complementary strand.

DNA synthesis proceeds in one direction from a point of origin

49.

1 point

Which of the following is not one of the steps of cellular respiration?

Citric acid cycle

In the chloroplast

Glycolysis

Fermentation

50.

1 point

Modifications needed for converting a primary transcript into a mature RNA are called ________.

RNA splicing

DNA processing

RNA processing

snRNPs